ID: 1027265694_1027265700

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1027265694 1027265700
Species Human (GRCh38) Human (GRCh38)
Location 7:76494135-76494157 7:76494163-76494185
Sequence CCTCAGAAGAGCAGTCTTGGGTG GGGTGCCCCTGACCCCTCGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 9, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!