ID: 1027303685_1027303697

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1027303685 1027303697
Species Human (GRCh38) Human (GRCh38)
Location 7:76869284-76869306 7:76869322-76869344
Sequence CCCCTTCAAACCCCAGGAACAGG TGCCGAAGGCCAGTGGGGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 32, 4: 221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!