ID: 1027313506_1027313515

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1027313506 1027313515
Species Human (GRCh38) Human (GRCh38)
Location 7:76970228-76970250 7:76970263-76970285
Sequence CCATTTTTGTGGAGCTCGGGGAT CTGTTGTCAGGGAGGTGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 25, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!