ID: 1027327252_1027327256

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1027327252 1027327256
Species Human (GRCh38) Human (GRCh38)
Location 7:77058282-77058304 7:77058302-77058324
Sequence CCAGAACACCCAGCTCATTTTTG TTGTGCTTCTAGAAGAGACAGGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 728, 3: 22820, 4: 64810} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!