ID: 1027347427_1027347437

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1027347427 1027347437
Species Human (GRCh38) Human (GRCh38)
Location 7:77275707-77275729 7:77275757-77275779
Sequence CCATGATTTTCCTGGGCCTCCTA AAAATCAACAATAAAACAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 190} {0: 1, 1: 0, 2: 14, 3: 335, 4: 3031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!