ID: 1027363827_1027363836

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1027363827 1027363836
Species Human (GRCh38) Human (GRCh38)
Location 7:77436037-77436059 7:77436077-77436099
Sequence CCCGGAGTCCCAGCTACTTGGGA CACTTCAAACCAGGAGACGGAGG
Strand - +
Off-target summary {0: 182, 1: 43757, 2: 157840, 3: 222557, 4: 227684} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!