ID: 1027363828_1027363836

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1027363828 1027363836
Species Human (GRCh38) Human (GRCh38)
Location 7:77436038-77436060 7:77436077-77436099
Sequence CCGGAGTCCCAGCTACTTGGGAG CACTTCAAACCAGGAGACGGAGG
Strand - +
Off-target summary {0: 23, 1: 871, 2: 3149, 3: 5019, 4: 6192} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!