ID: 1027371832_1027371840

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1027371832 1027371840
Species Human (GRCh38) Human (GRCh38)
Location 7:77514320-77514342 7:77514343-77514365
Sequence CCTTCTTCCCTCCCCAACCACAT GGAAAGAACTTGCATGCTAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 106, 4: 1016} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!