ID: 1027372374_1027372383

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1027372374 1027372383
Species Human (GRCh38) Human (GRCh38)
Location 7:77519697-77519719 7:77519743-77519765
Sequence CCTAAGAAAAATAAGACAGGGAA CAGAGGTACAATTTTAAATTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 39, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!