ID: 1027400180_1027400190

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1027400180 1027400190
Species Human (GRCh38) Human (GRCh38)
Location 7:77798764-77798786 7:77798787-77798809
Sequence CCTCCTCCCATCCTCCCTGCCCG CGCGCAGTGACTGCAGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 185, 4: 1606} {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!