ID: 1027404192_1027404195

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1027404192 1027404195
Species Human (GRCh38) Human (GRCh38)
Location 7:77842354-77842376 7:77842372-77842394
Sequence CCACTATGCCCAGCTAGATCTTG TCTTGTATTTTTAGTAGAGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 64, 3: 2609, 4: 33151} {0: 1062, 1: 197675, 2: 142860, 3: 66955, 4: 40175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!