ID: 1027406159_1027406161

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1027406159 1027406161
Species Human (GRCh38) Human (GRCh38)
Location 7:77863497-77863519 7:77863542-77863564
Sequence CCTTACATTGATTTCATATAAGG ACCTATAGAGATTGATTTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!