ID: 1027429455_1027429461

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1027429455 1027429461
Species Human (GRCh38) Human (GRCh38)
Location 7:78095325-78095347 7:78095347-78095369
Sequence CCTTCCCCACTATGGATATTCCA AAACTACAGCCTCTTCAGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!