ID: 1027466147_1027466154

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1027466147 1027466154
Species Human (GRCh38) Human (GRCh38)
Location 7:78516822-78516844 7:78516843-78516865
Sequence CCAAAGGCCCTTTTGTGCCTAAT ATAAACAATACCAAGACTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} {0: 1, 1: 0, 2: 0, 3: 12, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!