ID: 1027532791_1027532795

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1027532791 1027532795
Species Human (GRCh38) Human (GRCh38)
Location 7:79355440-79355462 7:79355466-79355488
Sequence CCTTGTAGCTACTAGTTTTATGG CCATCACTTTCTAGTGGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89} {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!