ID: 1027542966_1027542971

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1027542966 1027542971
Species Human (GRCh38) Human (GRCh38)
Location 7:79491731-79491753 7:79491745-79491767
Sequence CCATCTTCCTTGTCTTCACACTG TTCACACTGAGTAGGCTGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!