ID: 1027542966_1027542974

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1027542966 1027542974
Species Human (GRCh38) Human (GRCh38)
Location 7:79491731-79491753 7:79491758-79491780
Sequence CCATCTTCCTTGTCTTCACACTG GGCTGAGGGGGAAGAGGATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 41, 3: 421, 4: 2995}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!