ID: 1027670576_1027670580

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1027670576 1027670580
Species Human (GRCh38) Human (GRCh38)
Location 7:81091785-81091807 7:81091809-81091831
Sequence CCACCTCGGCCAAAGTGCTGGGA TACAGGTGTGATCCACCGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 81, 3: 314, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!