ID: 1027691564_1027691567

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1027691564 1027691567
Species Human (GRCh38) Human (GRCh38)
Location 7:81353378-81353400 7:81353412-81353434
Sequence CCAGATGTTCTTCGGGCTTCTTG CTAGATCACTAGCAAGATCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 38, 3: 234, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!