ID: 1027751995_1027751999

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1027751995 1027751999
Species Human (GRCh38) Human (GRCh38)
Location 7:82161025-82161047 7:82161050-82161072
Sequence CCCAAAGAAACAGGGCACCTTGT ATTTTTTATGCTAGGTTTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 3, 3: 48, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!