ID: 1027757814_1027757816

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1027757814 1027757816
Species Human (GRCh38) Human (GRCh38)
Location 7:82237513-82237535 7:82237534-82237556
Sequence CCTTATTCGTTTAAGTACTTCTT TTATTTTATAATCAAATTATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 105, 4: 1048}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!