ID: 1027760956_1027760959

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1027760956 1027760959
Species Human (GRCh38) Human (GRCh38)
Location 7:82278151-82278173 7:82278202-82278224
Sequence CCCATATAAAAATAGGAGATTGT CAATTTATTCAAAAGATGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!