|
Left Crispr |
Right Crispr |
| Crispr ID |
1027809757 |
1027809764 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:82880592-82880614
|
7:82880640-82880662
|
| Sequence |
CCATGTCTAGAAACATTTTTGGT |
CATTTAGTGGATAGAGGCCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 34, 3: 101, 4: 392} |
{0: 6, 1: 44, 2: 369, 3: 941, 4: 1428} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|