ID: 1027830541_1027830545

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1027830541 1027830545
Species Human (GRCh38) Human (GRCh38)
Location 7:83171519-83171541 7:83171543-83171565
Sequence CCATTTCCCCTTCAGAAGTGACT GAGATGAGAAGCCAAGTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 29, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!