ID: 1027830544_1027830550

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1027830544 1027830550
Species Human (GRCh38) Human (GRCh38)
Location 7:83171527-83171549 7:83171563-83171585
Sequence CCTTCAGAAGTGACTAGAGATGA AGGGGACTTAATGTGTTCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!