ID: 1027835843_1027835845

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1027835843 1027835845
Species Human (GRCh38) Human (GRCh38)
Location 7:83240808-83240830 7:83240850-83240872
Sequence CCTGCTTTAAACTTGTTGGATGC TCCATCAATTTTCTGTTTTTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 48, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!