ID: 1027967397_1027967406

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1027967397 1027967406
Species Human (GRCh38) Human (GRCh38)
Location 7:85029578-85029600 7:85029616-85029638
Sequence CCAAACTGGACTAGAGTGCAGAA ATGCCAGGGGGATTTCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 111} {0: 1, 1: 1, 2: 6, 3: 30, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!