ID: 1027978472_1027978478

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1027978472 1027978478
Species Human (GRCh38) Human (GRCh38)
Location 7:85186903-85186925 7:85186933-85186955
Sequence CCGAGAGCCGCGCTAGGACAGGC AAGGCACCAGCTGGAGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76} {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!