ID: 1028090882_1028090887

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1028090882 1028090887
Species Human (GRCh38) Human (GRCh38)
Location 7:86699310-86699332 7:86699334-86699356
Sequence CCACCCCTTGTGAGTTATAAGTC ATCCAGATGCAGAATCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56} {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!