ID: 1028121399_1028121416

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1028121399 1028121416
Species Human (GRCh38) Human (GRCh38)
Location 7:87059668-87059690 7:87059709-87059731
Sequence CCCGGGCAGCCAGCGCCGATGCT GGGACCGCGGGGCGCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 124} {0: 1, 1: 2, 2: 14, 3: 119, 4: 792}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!