ID: 1028121400_1028121412

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1028121400 1028121412
Species Human (GRCh38) Human (GRCh38)
Location 7:87059669-87059691 7:87059698-87059720
Sequence CCGGGCAGCCAGCGCCGATGCTC CGCCGGAGGGAGGGACCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115} {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!