ID: 1028130575_1028130577

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1028130575 1028130577
Species Human (GRCh38) Human (GRCh38)
Location 7:87167834-87167856 7:87167865-87167887
Sequence CCTATCTATACAGATGTAATCCT TCTAAGCTAGAATTTTTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110} {0: 1, 1: 0, 2: 2, 3: 13, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!