|
Left Crispr |
Right Crispr |
Crispr ID |
1028131507 |
1028131511 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:87181002-87181024
|
7:87181018-87181040
|
Sequence |
CCTGCCACCAGCTAATTTTTCTG |
TTTTCTGTTTTTGGTAGAGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 17, 3: 71, 4: 557} |
{0: 14, 1: 754, 2: 20911, 3: 237497, 4: 154421} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|