|
Left Crispr |
Right Crispr |
| Crispr ID |
1028131507 |
1028131513 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:87181002-87181024
|
7:87181020-87181042
|
| Sequence |
CCTGCCACCAGCTAATTTTTCTG |
TTCTGTTTTTGGTAGAGATGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 17, 3: 71, 4: 557} |
{0: 9, 1: 392, 2: 10814, 3: 117742, 4: 210764} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|