ID: 1028160102_1028160118

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1028160102 1028160118
Species Human (GRCh38) Human (GRCh38)
Location 7:87475719-87475741 7:87475738-87475760
Sequence CCCCCGCCCCCGCCCCCGCCCCC CCCCCACGCGCGTCCGGCCCGGG
Strand - +
Off-target summary {0: 91, 1: 160, 2: 656, 3: 4846, 4: 14217} {0: 1, 1: 0, 2: 0, 3: 24, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!