ID: 1028160103_1028160118

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1028160103 1028160118
Species Human (GRCh38) Human (GRCh38)
Location 7:87475720-87475742 7:87475738-87475760
Sequence CCCCGCCCCCGCCCCCGCCCCCC CCCCCACGCGCGTCCGGCCCGGG
Strand - +
Off-target summary {0: 14, 1: 170, 2: 449, 3: 2682, 4: 11272} {0: 1, 1: 0, 2: 0, 3: 24, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!