ID: 1028175918_1028175925

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1028175918 1028175925
Species Human (GRCh38) Human (GRCh38)
Location 7:87657897-87657919 7:87657929-87657951
Sequence CCTCCCACCTTCCCCTGTGGGAG AAAAAGCTAGTTAAAACAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 12, 3: 66, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!