|
Left Crispr |
Right Crispr |
| Crispr ID |
1028188584 |
1028188588 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:87819262-87819284
|
7:87819290-87819312
|
| Sequence |
CCAGGGTACACCAAAGGTTAGTC |
AGGCCATTACATAATGGTAAAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 5714, 1: 3583, 2: 2208, 3: 1732, 4: 1867} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|