ID: 1028192172_1028192178

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1028192172 1028192178
Species Human (GRCh38) Human (GRCh38)
Location 7:87866344-87866366 7:87866395-87866417
Sequence CCTTTAAAAATGTCATCTAACTC AAGTCTGTTGCCAGATGAATTGG
Strand - +
Off-target summary No data {0: 17, 1: 47, 2: 226, 3: 374, 4: 665}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!