ID: 1028202214_1028202217

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1028202214 1028202217
Species Human (GRCh38) Human (GRCh38)
Location 7:87975044-87975066 7:87975059-87975081
Sequence CCTTTTTCCATGTGAGGTAACAT GGTAACATGTTCGTAGGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 168, 3: 630, 4: 1884} {0: 1, 1: 3, 2: 22, 3: 109, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!