ID: 1028207662_1028207667

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1028207662 1028207667
Species Human (GRCh38) Human (GRCh38)
Location 7:88034819-88034841 7:88034856-88034878
Sequence CCCACAATTGCTGTGCTCTCCCT GTTTCTCTCTCTGTGCCATGAGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 62, 3: 137, 4: 359} {0: 1, 1: 7, 2: 27, 3: 114, 4: 596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!