ID: 1028207662_1028207668

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1028207662 1028207668
Species Human (GRCh38) Human (GRCh38)
Location 7:88034819-88034841 7:88034866-88034888
Sequence CCCACAATTGCTGTGCTCTCCCT CTGTGCCATGAGGCTGCTGCTGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 62, 3: 137, 4: 359} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!