ID: 1028286684_1028286688

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1028286684 1028286688
Species Human (GRCh38) Human (GRCh38)
Location 7:89011569-89011591 7:89011611-89011633
Sequence CCAAATGGGAGCAATTGGCTAAA ATGCAACTCCACAACCCAATAGG
Strand - +
Off-target summary {0: 2, 1: 53, 2: 1578, 3: 1927, 4: 1587} {0: 1, 1: 0, 2: 11, 3: 193, 4: 863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!