ID: 1028378603_1028378607

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1028378603 1028378607
Species Human (GRCh38) Human (GRCh38)
Location 7:90174212-90174234 7:90174239-90174261
Sequence CCAGGCATGATGATTCACATCAG CTCAACAATTTGGGAGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 306, 4: 2977} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!