ID: 1028417585_1028417594

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1028417585 1028417594
Species Human (GRCh38) Human (GRCh38)
Location 7:90596369-90596391 7:90596412-90596434
Sequence CCACGGCGGCGGCGAGCGCGGCC CGCCCCCGCCCGCCCAGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 422} {0: 1, 1: 2, 2: 4, 3: 39, 4: 387}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!