ID: 1028417589_1028417599

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1028417589 1028417599
Species Human (GRCh38) Human (GRCh38)
Location 7:90596394-90596416 7:90596418-90596440
Sequence CCCCGGCACCACGTAAACCGCCC CGCCCGCCCAGCTGCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37} {0: 1, 1: 0, 2: 4, 3: 30, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!