ID: 1028432805_1028432813

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1028432805 1028432813
Species Human (GRCh38) Human (GRCh38)
Location 7:90767086-90767108 7:90767113-90767135
Sequence CCATACTGACCCATGCTAAACCA CCCCATGCACAGTGTCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86} {0: 3, 1: 3, 2: 8, 3: 40, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!