ID: 1028453667_1028453676

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1028453667 1028453676
Species Human (GRCh38) Human (GRCh38)
Location 7:91015261-91015283 7:91015305-91015327
Sequence CCTTCCTCAAGACACTCCCTGTT TGTACATTCTTCACTGCTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 248} {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!