ID: 1028453669_1028453676

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1028453669 1028453676
Species Human (GRCh38) Human (GRCh38)
Location 7:91015277-91015299 7:91015305-91015327
Sequence CCCTGTTTTCACTCCCTTACCCA TGTACATTCTTCACTGCTATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 312} {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!