ID: 1028455161_1028455164

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1028455161 1028455164
Species Human (GRCh38) Human (GRCh38)
Location 7:91030586-91030608 7:91030630-91030652
Sequence CCCTGTGAAAGAGGAGGTAAGAC GCAAGCCTGTCACCTGGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!